View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1116_high_10 (Length: 302)

Name: NF1116_high_10
Description: NF1116
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1116_high_10
NF1116_high_10
[»] chr1 (2 HSPs)
chr1 (26-189)||(47289175-47289338)
chr1 (212-275)||(47289106-47289170)
[»] scaffold0179 (1 HSPs)
scaffold0179 (192-261)||(33213-33283)


Alignment Details
Target: chr1 (Bit Score: 148; Significance: 4e-78; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 26 - 189
Target Start/End: Complemental strand, 47289338 - 47289175
Alignment:
Q  26 atcaccttcaacccatgatgaagagagtgaatcaattgtgattgggaggaggccaagagattgagttgtcgacgcaagtgagggaatacggcgacgaatg 125  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||  |||||    
T  47289338 atcaccttcaacccatgatgaagagagtgaatcaattgtgattgggaggaggccaagagattgagttgtcgacgcaagtgagggaacacggcggtgaatg 47289239  T
Q  126 agaccaatgtccatgaggaaacgaagagagtgagaggagatcgagcggttgggaggagacaaag 189  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  47289238 agaccaatgtccatgaggaaacgaagagagtgggaggagatcgagcggttgggaggagacaaag 47289175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 212 - 275
Target Start/End: Complemental strand, 47289170 - 47289106
Alignment:
Q  212 tgggcttcatcccgga-cttagggaaagagggatggaagtgagagcaagggcccaaagtttcaga 275  Q
    ||||||||||||| || ||||||||||||||||| ||| ||||||||||||| ||||||||||||    
T  47289170 tgggcttcatccccgaacttagggaaagagggatcgaactgagagcaagggcacaaagtttcaga 47289106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0179 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0179
Description:

Target: scaffold0179; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 192 - 261
Target Start/End: Complemental strand, 33283 - 33213
Alignment:
Q  192 agttggagagacaacgacggtgggcttcat-cccggacttagggaaagagggatggaagtgagagcaaggg 261  Q
    |||||||||||||| ||||||||||||||| |||| | ||||||||||||||||||||  |||| ||||||    
T  33283 agttggagagacaatgacggtgggcttcatccccgaatttagggaaagagggatggaaccgagaacaaggg 33213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University