View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11168_low_87 (Length: 214)

Name: NF11168_low_87
Description: NF11168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11168_low_87
NF11168_low_87
[»] chr3 (1 HSPs)
chr3 (7-214)||(54264415-54264628)


Alignment Details
Target: chr3 (Bit Score: 114; Significance: 5e-58; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 114; E-Value: 5e-58
Query Start/End: Original strand, 7 - 214
Target Start/End: Original strand, 54264415 - 54264628
Alignment:
Q  7 aacacctactcaaataaacacacacatagagagagaatgtggtgatgagtttgaattcaagattcttcataaaatgtagaaataagaaagaaagnnnnnn 106  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||          
T  54264415 aacacctactcaaataaacatacacatagagagagaatgtggtgatgagtttgaattcaagattcttcataaaatgtagaaataagaaagaaagaaaaaa 54264514  T
Q  107 ngctcatatttacttgtcatcttc------nnnnnnnnnnnnnnnncttcatctattcataaatcaattaataatgttgcatttgattttgaaaataaca 200  Q
     |||||||||||||||||||||||                      |||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  54264515 agctcatatttacttgtcatcttcaaaacaaaaacaaaaacaaaaacttcatctattcataaatcaattaataatgttgcatttaattttgaaaataaca 54264614  T
Q  201 aataaaaaaggagc 214  Q
    ||||||||||||||    
T  54264615 aataaaaaaggagc 54264628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University