View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1115_low_20 (Length: 291)

Name: NF1115_low_20
Description: NF1115
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1115_low_20
NF1115_low_20
[»] chr3 (1 HSPs)
chr3 (20-77)||(25377071-25377128)
[»] chr7 (1 HSPs)
chr7 (26-68)||(41422285-41422327)


Alignment Details
Target: chr3 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 20 - 77
Target Start/End: Original strand, 25377071 - 25377128
Alignment:
Q  20 caagtacatgttggaccaattttttcataggtccaaattatactcaaccccacataat 77  Q
    |||||| ||||||||||||||||| |||||||||||||||||||||||||||| ||||    
T  25377071 caagtatatgttggaccaatttttccataggtccaaattatactcaaccccacgtaat 25377128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 26 - 68
Target Start/End: Complemental strand, 41422327 - 41422285
Alignment:
Q  26 catgttggaccaattttttcataggtccaaattatactcaacc 68  Q
    |||||||||||||||||| ||||| ||||||||||||| ||||    
T  41422327 catgttggaccaatttttccatagatccaaattatactgaacc 41422285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University