View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11159_low_17 (Length: 242)

Name: NF11159_low_17
Description: NF11159
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11159_low_17
NF11159_low_17
[»] chr1 (2 HSPs)
chr1 (104-242)||(35817107-35817245)
chr1 (1-38)||(35817310-35817347)


Alignment Details
Target: chr1 (Bit Score: 139; Significance: 7e-73; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 139; E-Value: 7e-73
Query Start/End: Original strand, 104 - 242
Target Start/End: Complemental strand, 35817245 - 35817107
Alignment:
Q  104 caaatatttcttattaatttgtttaagatatgacacatggaaaccaaatactaaataaacataaactgagataagcttgtgtcagccccgtgatttgggg 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35817245 caaatatttcttattaatttgtttaagatatgacacatggaaaccaaatactaaataaacataaactgagataagcttgtgtcagccccgtgatttgggg 35817146  T
Q  204 ctgttctaaatgcaatgatccctgacttcaattcttctc 242  Q
    |||||||||||||||||||||||||||||||||||||||    
T  35817145 ctgttctaaatgcaatgatccctgacttcaattcttctc 35817107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 35817347 - 35817310
Alignment:
Q  1 tgttggataatgattcaaggtaagccaaatagttgtaa 38  Q
    ||||||||||||||||||||||||||||||||||||||    
T  35817347 tgttggataatgattcaaggtaagccaaatagttgtaa 35817310  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University