View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11154_low_18 (Length: 253)

Name: NF11154_low_18
Description: NF11154
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11154_low_18
NF11154_low_18
[»] chr1 (2 HSPs)
chr1 (21-179)||(50338467-50338625)
chr1 (188-237)||(50338702-50338751)


Alignment Details
Target: chr1 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 21 - 179
Target Start/End: Original strand, 50338467 - 50338625
Alignment:
Q  21 agtaccattgctcaaagaggagttcaattggttggaacggcacatggaacaaccattgagagcataatgaagaatccttatcttcagatccttgttggtg 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  50338467 agtaccattgctcaaagaggagttcaattggttggaacggcacatggaacaaccattgaaagcataatgaagaatccttatcttcagatccttgttggtg 50338566  T
Q  121 gtatagaggtgcaaaagctactcttatttattttccttcaagtttatgatttataataa 179  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50338567 gtatagaggtgcaaaagctactcttatttattttccttcaagtttatgatttataataa 50338625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 188 - 237
Target Start/End: Original strand, 50338702 - 50338751
Alignment:
Q  188 gtagcatatcctaatgaaatatgtatagcgcgtgtccacgttaatgatgt 237  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50338702 gtagcatatcctaatgaaatatgtatagcgcgtgtccacgttaatgatgt 50338751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University