View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1114_low_181 (Length: 202)

Name: NF1114_low_181
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1114_low_181
NF1114_low_181
[»] chr8 (1 HSPs)
chr8 (14-131)||(3607640-3607757)


Alignment Details
Target: chr8 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 14 - 131
Target Start/End: Complemental strand, 3607757 - 3607640
Alignment:
Q  14 gagagtatgctgggctggtgaaaataaacaatcagcaaaacaagtaatgaatttgaagttcctacgtctaaccaataataagtggcaattaaaataataa 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  3607757 gagagtatgctgggctggtgaaaataaacaatcagcaaaacaagtaatgaatttgaagttcctacgtctaaccaataataagtggcaattaaaataataa 3607658  T
Q  114 taatcagaattatctacc 131  Q
    |||||| ||| |||||||    
T  3607657 taatcataataatctacc 3607640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University