View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1114_low_168 (Length: 211)

Name: NF1114_low_168
Description: NF1114
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1114_low_168
NF1114_low_168
[»] chr4 (1 HSPs)
chr4 (52-186)||(327890-328023)


Alignment Details
Target: chr4 (Bit Score: 92; Significance: 7e-45; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 52 - 186
Target Start/End: Original strand, 327890 - 328023
Alignment:
Q  52 agaataccacaatttagaatttattttttaaagaaattattgttagtannnnnnnnnctttcatcaatgtctgatgattaattgtgtaattaactattaa 151  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||         |||||||||||||||||||||||||||||||||||||||||||    
T  327890 agaataccacaatttagaattt-ttttttaaagaaattattgttagtatttttttttctttcatcaatgtctgatgattaattgtgtaattaactattaa 327988  T
Q  152 tggaaaaattaatggatgaatgaatgcagaataat 186  Q
    |||||  ||||||||||||||||||||||||||||    
T  327989 tggaatgattaatggatgaatgaatgcagaataat 328023  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University