View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11148_low_25 (Length: 250)

Name: NF11148_low_25
Description: NF11148
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11148_low_25
NF11148_low_25
[»] chr3 (1 HSPs)
chr3 (1-237)||(35257683-35257919)


Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 237
Target Start/End: Original strand, 35257683 - 35257919
Alignment:
Q  1 tctagttggcaaaccaatgagtatttccacggtagccatagaatcaaagttaaagttgctggctttgtttgtatggaggaccaaaaacttttttcatatc 100  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35257683 tctagttggcaaaccaatcagtatttccacggtagccatagaatcaaagttaaagttgctggctttgtttgtatggaggaccaaaaacttttttcatatc 35257782  T
Q  101 ttcaaacgaatacacttattaagataaacaatttaacccttatgcaaacacatgctacggtagttaaaagactaatatgaagtaaactgggatattgcat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  35257783 ttcaaacgaatacacttattaagataaacaatttaacccttatgcaaacacatgctacgatagttaaaagactaatatgaagtaaactgggatattgcat 35257882  T
Q  201 gttacagtatcggctaaccatgtcatacgtatagtct 237  Q
     ||||||||||||||||| ||||||||||||||||||    
T  35257883 attacagtatcggctaactatgtcatacgtatagtct 35257919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University