View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11145_low_5 (Length: 303)

Name: NF11145_low_5
Description: NF11145
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11145_low_5
NF11145_low_5
[»] chr7 (1 HSPs)
chr7 (17-303)||(972098-972384)


Alignment Details
Target: chr7 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 17 - 303
Target Start/End: Complemental strand, 972384 - 972098
Alignment:
Q  17 actcacaaattgtcaaaactacctggaaatatagcaagcgatagcttaccgataaacttaaggaaactctcaatcatctacatatatggggaacataaaa 116  Q
    ||||||||||||||||||||||||| |||| ||||||| ||||||||||  ||||||||||||||||||| ||| |||||||||||||||||||| ||||    
T  972384 actcacaaattgtcaaaactacctgaaaatgtagcaagggatagcttactaataaacttaaggaaactcttaattatctacatatatggggaacagaaaa 972285  T
Q  117 atttggagaggttcctaggagaattaacaaaattcaacaagagctcaaagtactcaagaagtctatccctaatgtatatactcttcaaaagattaaagaa 216  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||    
T  972284 atttggagaggttcctaggagaattaacaaaattcaacaagagctcaaagtactcaagaagtctatccctgatgtatatactctccaaaagattaaagaa 972185  T
Q  217 aaagagaagcttcttgatgatactatgaaagaggatgaactttggtgggctcagagagcaaaatctcaatggcttcaagcatgagat 303  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||    
T  972184 aaagagaagcttcttgatgatactacgaaagaggatgaactttggtgggctcagagagcaaaatctcactggcttcaagcacgagat 972098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University