View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11144_high_16 (Length: 324)

Name: NF11144_high_16
Description: NF11144
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11144_high_16
NF11144_high_16
[»] chr2 (1 HSPs)
chr2 (11-287)||(35604184-35604459)


Alignment Details
Target: chr2 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 11 - 287
Target Start/End: Original strand, 35604184 - 35604459
Alignment:
Q  11 cagagactacgggttttcaccttaaggtgcaagaacaatatgaatagcattaagagcgggaggtaagacaccggaggccagccaagaggaagcaaaggaa 110  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35604184 cagagactacgggttttcaccttaaggtgcaagaacaatatgagtagcattaagagcgggaggtaagacaccggaggccagccaagaggaagcaaaggaa 35604283  T
Q  111 taaacttccccttcaatctcatcccataaacggtggtagaaggttggattaaggttttccgaaccaatgatttgtatgagtgcatgctagcttccttgaa 210  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  35604284 taaacttccccttcaatctcatcccataaacggtggtagaaggttggattaaggttttccgaaccaatgatttgtatgagtgcatgctagcttccttgaa 35604383  T
Q  211 ttccacctctacaaaaggttaagcaagataatgagtatcttcatccgtcaccattgattgcatgcaaggttcaatct 287  Q
    ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
T  35604384 ttccatctctacaaaaggttaagcaagataat-agtatcttcatccgtcaccattgattgcatgcaaggttcaatct 35604459  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University