View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11142_low_38 (Length: 329)

Name: NF11142_low_38
Description: NF11142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11142_low_38
NF11142_low_38
[»] chr3 (1 HSPs)
chr3 (16-297)||(30590939-30591220)


Alignment Details
Target: chr3 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 16 - 297
Target Start/End: Complemental strand, 30591220 - 30590939
Alignment:
Q  16 atattaattaaagatggcctgtgcaaatattacgtgcaagtaagtgggcagctttagggaatatgcatggtgagtaggggccggacattggaattttcca 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  30591220 atattaattaaagatggcctgtgcaaatattacgtgcaagtaagtgggcagctttagggaatatgcatggtgagtaggggccggacattggaattttcca 30591121  T
Q  116 attgaagtaagttgcaaatgcaatgcaaaaatacagtgctaaatatgtggacacctctgcatattgttgttctattcagcggagtttctgggctacactt 215  Q
    ||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||    
T  30591120 attgaagtaagttacaaatgcaatgcgaaaatacagtgctaaatatgtggacacctctgcatattgttgttctattcagcggaatttctgggctacactt 30591021  T
Q  216 ttgatgtatcatttcacttatacagtagttgtctatcttagtgctgtacaaaatgatggagactagggctcactctttggtt 297  Q
    ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  30591020 ttgatgtatcatttcacttatacagtagttgtctagcttagtgctgtacaaaatgatggagactagggctcactctttggtt 30590939  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University