View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11142_low_37 (Length: 336)

Name: NF11142_low_37
Description: NF11142
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11142_low_37
NF11142_low_37
[»] chr4 (1 HSPs)
chr4 (16-325)||(28233204-28233513)


Alignment Details
Target: chr4 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 16 - 325
Target Start/End: Original strand, 28233204 - 28233513
Alignment:
Q  16 gagaaaaccgctggatatcaaatctggaatcaagatcaataaatagaaccaaatgttcaaatccaccgtagtttatcccattccagtctttgggaagaat 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  28233204 gagaaaaccgctggatatcaaatctggaatcaagatcaataaatagaaccaaatgttcaaatccaccgtagtttatccccttccagtctttgggaagaat 28233303  T
Q  116 gcaagtgattgcagtttgaatgaggatttgagttttggcggatggcgaaggaccgacgagttcgaggacgttgccgacgcggagaggaactctgtgaagc 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28233304 gcaagtgattgcagtttgaatgaggatttgagttttggcggatggcgaaggaccgacgagttcgaggacgttgccgacgcggagaggaactctgtgaagc 28233403  T
Q  216 ggcttagggaggatgaaaggtcggactctccatactcttttcagcatctcgctgccgctttcgtctccggcaatccagttttggagatgtggtctctcgt 315  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  28233404 ggcttagggaggatgaaaggtcggactctccatactcttttcagcatttcgctgccgctttcgtctccggcaatccagttttggaggtgtggtctctcgt 28233503  T
Q  316 gatgattcat 325  Q
    ||||||||||    
T  28233504 gatgattcat 28233513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University