View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11137_low_20 (Length: 431)

Name: NF11137_low_20
Description: NF11137
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11137_low_20
NF11137_low_20
[»] chr3 (1 HSPs)
chr3 (312-392)||(31698408-31698490)


Alignment Details
Target: chr3 (Bit Score: 64; Significance: 8e-28; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 312 - 392
Target Start/End: Original strand, 31698408 - 31698490
Alignment:
Q  312 caatcacatgtttaatttgaacatattttgaatatgtaaatgacaca--ttacatcagacaagaagttttacatcaatatagc 392  Q
    |||||||||||||||||||||||||||||||||||||||||||||||  |||  |||||||||||||||||||||||||||||    
T  31698408 caatcacatgtttaatttgaacatattttgaatatgtaaatgacacattttatttcagacaagaagttttacatcaatatagc 31698490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University