View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11136_low_3 (Length: 224)

Name: NF11136_low_3
Description: NF11136
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11136_low_3
NF11136_low_3
[»] chr1 (1 HSPs)
chr1 (28-211)||(3307688-3307871)


Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 28 - 211
Target Start/End: Complemental strand, 3307871 - 3307688
Alignment:
Q  28 tacttcatcctcatacaagtctcatcaaaagtaacatcattgctcatcatgacccttaagcctccaggttccatactcaattgaataacttgtaaccctt 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  3307871 tacttcatcctcatacaagtctcatcaaaagtaacatcattgctcatcatgacccttaagcctccaggttccatactcaattcaataacttgtaaccctt 3307772  T
Q  128 atgccttcaggataaccaatgaagacacaatcgagagctctaacttcaaacctccacaggtgtcttgaaatttattcatattga 211  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||    
T  3307771 atgccttctggataaccaatgaagacacaatcgagagctctaacttcaaacctccataggtgtcttgaaatttattcatattga 3307688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University