View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11133_low_64 (Length: 221)

Name: NF11133_low_64
Description: NF11133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11133_low_64
NF11133_low_64
[»] chr3 (1 HSPs)
chr3 (12-203)||(53271980-53272171)


Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 12 - 203
Target Start/End: Complemental strand, 53272171 - 53271980
Alignment:
Q  12 gagatgaactgcgaattctatttaaaaatagtaaataacagctgacatgcatatttataagatactacagctttacaacgtacaatcagatactacattt 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53272171 gagatgaactgcgaattctatttaaaaatagtaaataacagctgacatgcatatttataagatactacagctttacaacgtacaatcagatactacattt 53272072  T
Q  112 aatgctgaatgtaccattattactctcttcaatttgctgcatgctcgtttttattaattcatcaaattaactcttccgatttaaaggaagtt 203  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  53272071 aatgctgaatgtaccattattactctcttcaatttgttgcatgctcgtttttattaattcatcaaattaactcttccgatttaaaggaagtt 53271980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University