View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11133_high_55 (Length: 237)

Name: NF11133_high_55
Description: NF11133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11133_high_55
NF11133_high_55
[»] chr2 (1 HSPs)
chr2 (41-207)||(7889078-7889244)


Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 41 - 207
Target Start/End: Complemental strand, 7889244 - 7889078
Alignment:
Q  41 tggtggaacttattctttatttttcatctgaatcttttcttattacaggggaaccatcttagacacaaattagacaacctgataacgatggtaatgatca 140  Q
    ||||||||||||||||||||||| ||||||||||||||||||| ||| |||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  7889244 tggtggaacttattctttattttccatctgaatcttttcttatcacaagggaaccaacttagacacaaattagacaacctgataacgatggtaatgatca 7889145  T
Q  141 acagcaacatccccgttagttccatccaatattgttcctgaaagcaactgcatgtgagagtcgagtg 207  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7889144 acagcaacatccccattagttccatccaatattgttcctgaaagcaactgcatgtgagagtcgagtg 7889078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University