View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11127_high_30 (Length: 289)

Name: NF11127_high_30
Description: NF11127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11127_high_30
NF11127_high_30
[»] chr8 (1 HSPs)
chr8 (157-274)||(24942002-24942116)


Alignment Details
Target: chr8 (Bit Score: 92; Significance: 1e-44; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 157 - 274
Target Start/End: Original strand, 24942002 - 24942116
Alignment:
Q  157 aggtgtttgtttgagtacgtatagagacttggatgagtcactatgtgagttttagaggaaagttacttcaaaaacgcatatgagcatattgacatatgtt 256  Q
    |||||||||||||||   ||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||    
T  24942002 aggtgtttgtttgag---gtatagagacttggatgtgtcactatgtgagttttagaggaaagttacttccaaaacgcatatgagcatattgatatatgtt 24942098  T
Q  257 gttctattagttacatgt 274  Q
    ||||||||||||||||||    
T  24942099 gttctattagttacatgt 24942116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University