View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11121_low_88 (Length: 236)

Name: NF11121_low_88
Description: NF11121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11121_low_88
NF11121_low_88
[»] chr2 (1 HSPs)
chr2 (1-236)||(44144613-44144848)


Alignment Details
Target: chr2 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 44144848 - 44144613
Alignment:
Q  1 ctaatccccggagccttttaactttgtcttgttttccttttagcagtaacgtttctttgcattgatgatgtcatggaagtaaatatttttgttgcaaaaa 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |||||||||||||||||||||||||||    
T  44144848 ctaatccccggagccttttaactttgtcttgttttccttttagcagttacgtttctttgcactgatgatgtcgtggaagtaaatatttttgttgcaaaaa 44144749  T
Q  101 ttagataataacgcctcgttttgtaaggctatgatgtcaaattccagtatgtacaaaactttatctggtttaatccatgtaaggagagaaacttcttgtt 200  Q
    |||||||||||||||| ||||  ||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
T  44144748 ttagataataacgccttgtttcctaaggctatgatgtcgaattccagtatgtacaaaactttatctggtttaatccatctaaggagagaaacttcttgtt 44144649  T
Q  201 aaattacaggccaagtaaaatttcttgcaaagcttc 236  Q
    ||||||||||||||||||||||||||||||||||||    
T  44144648 aaattacaggccaagtaaaatttcttgcaaagcttc 44144613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University