View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1111_low_247 (Length: 225)

Name: NF1111_low_247
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1111_low_247
NF1111_low_247
[»] chr1 (2 HSPs)
chr1 (60-158)||(31052586-31052684)
chr1 (166-206)||(46424154-46424194)
[»] chr4 (1 HSPs)
chr4 (166-206)||(9452967-9453007)


Alignment Details
Target: chr1 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 60 - 158
Target Start/End: Complemental strand, 31052684 - 31052586
Alignment:
Q  60 aataagataaaaattggcctaaatatatgttatattatatgctgtgaaatatatttcagaatcacatcaaattgaaatcaatcgaagcaacagacaaag 158  Q
    |||||||||||| |||||||||||||||||||||||||||||| ||||||||| |||| ||||||| |||||||| || ||||||||||||||| ||||    
T  31052684 aataagataaaatttggcctaaatatatgttatattatatgctatgaaatatacttcataatcacaccaaattgagattaatcgaagcaacagataaag 31052586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 166 - 206
Target Start/End: Complemental strand, 46424194 - 46424154
Alignment:
Q  166 tgttgctcttttaagatgaagcggtgaattcattaaatata 206  Q
    ||||||||||||||||||||||| |||||||||||||||||    
T  46424194 tgttgctcttttaagatgaagcgatgaattcattaaatata 46424154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 166 - 206
Target Start/End: Complemental strand, 9453007 - 9452967
Alignment:
Q  166 tgttgctcttttaagatgaagcggtgaattcattaaatata 206  Q
    ||||||||||||||||||||||||| |||||||||||||||    
T  9453007 tgttgctcttttaagatgaagcggtaaattcattaaatata 9452967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University