View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1111_high_192 (Length: 210)

Name: NF1111_high_192
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1111_high_192
NF1111_high_192
[»] chr2 (1 HSPs)
chr2 (1-133)||(32866670-32866802)


Alignment Details
Target: chr2 (Bit Score: 108; Significance: 2e-54; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 1 - 133
Target Start/End: Complemental strand, 32866802 - 32866670
Alignment:
Q  1 agagaatatgtatattttatgttcacnnnnnnnaaggtacagttcaaatttgtttctatgtattcggttggatttggctgtggagattttacgattacaa 100  Q
    ||||||||||||||||||||||||||       ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32866802 agagaatatgtatattttatgttcactttttttaaggtacagttcagatttgtttctatgtattcggttggatttggctgtggagattttacgattacaa 32866703  T
Q  101 gcatgtgaatgttgccgccgctgtgagtataat 133  Q
    |||||||||||||||||||||||||||||||||    
T  32866702 gcatgtgaatgttgccgccgctgtgagtataat 32866670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University