View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1111_high_128 (Length: 294)

Name: NF1111_high_128
Description: NF1111
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1111_high_128
NF1111_high_128
[»] chr8 (1 HSPs)
chr8 (53-239)||(11332016-11332202)


Alignment Details
Target: chr8 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 53 - 239
Target Start/End: Original strand, 11332016 - 11332202
Alignment:
Q  53 gagatgaagataagtatctgaataccgagagcttcagaaatgaagagataagcgatgataaccaacggaagggagagaagaaggatgaagccacggagga 152  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11332016 gagatgaagataagtatctgaataccgagagcttcagaaatgaagagataagcgatgataaccaacggaagggagagaagaaggatgaagccacggagga 11332115  T
Q  153 ggctaccagcttcaacggcgacaagcatgaagtaaggaaaagagcttctcgaaatgagaagcgtgccatcgagatcagcggcaacag 239  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
T  11332116 ggctaccagcttcaacggcgacaagcatgaagtaaggaaaagagcttctcgaaatcagaagcgtgccatcgagatcagcggcaacag 11332202  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University