View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11110_high_14 (Length: 233)

Name: NF11110_high_14
Description: NF11110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11110_high_14
NF11110_high_14
[»] chr8 (2 HSPs)
chr8 (16-132)||(20658899-20659015)
chr8 (143-219)||(20658709-20658785)


Alignment Details
Target: chr8 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 16 - 132
Target Start/End: Complemental strand, 20659015 - 20658899
Alignment:
Q  16 cagagacggacactaacaaatatagttacactcaatttcttctatttgtatataaaaaccaaaaataaaattcagagtctatccaagaacttgctatcga 115  Q
    |||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20659015 cagacacggacactaacaaatatagttacactcaatttcttctatttgcatataaaaaccaaaaataaaattcagagtctatccaagaacttgctatcga 20658916  T
Q  116 gcaactcatgtagtaag 132  Q
    |||||||||||||||||    
T  20658915 gcaactcatgtagtaag 20658899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 143 - 219
Target Start/End: Complemental strand, 20658785 - 20658709
Alignment:
Q  143 cactaatagagggacgaatgtaatttttatctacataacacaaacacatcagattgaatagtacctaatgttgaaaa 219  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||    
T  20658785 cactaatagagggatgaatgtaatttttatctacataacacaaacacatcagattgaatagtgtctaatgttgaaaa 20658709  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University