View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1110_low_38 (Length: 238)

Name: NF1110_low_38
Description: NF1110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1110_low_38
NF1110_low_38
[»] chr8 (1 HSPs)
chr8 (119-203)||(29129872-29129956)


Alignment Details
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 119 - 203
Target Start/End: Original strand, 29129872 - 29129956
Alignment:
Q  119 tttctctattaagtcttcgttccatttttcacttctctactctctttacactttttctcttacatttctaacaaacaaaatccac 203  Q
    |||||||||||||||||||||||||||| || |||||||||||||| || ||||||||||||||||||||||||| |||| ||||    
T  29129872 tttctctattaagtcttcgttccattttacatttctctactctcttcactctttttctcttacatttctaacaaataaaacccac 29129956  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University