View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1110_low_34 (Length: 251)

Name: NF1110_low_34
Description: NF1110
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1110_low_34
NF1110_low_34
[»] chr3 (2 HSPs)
chr3 (123-249)||(11074924-11075050)
chr3 (139-238)||(11055644-11055744)


Alignment Details
Target: chr3 (Bit Score: 119; Significance: 7e-61; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 119; E-Value: 7e-61
Query Start/End: Original strand, 123 - 249
Target Start/End: Complemental strand, 11075050 - 11074924
Alignment:
Q  123 tttatttatgtcatcttcttcatcttcaaatttatcaaccttcttcatctacattttgacttcaaaagcaaaaagaaatatccatcatatttatctcatc 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||    
T  11075050 tttatttatgtcatcttcttcatcttcaaatttatcaaccttcttcatctgcattttgacttcaaaagcaaaaagaaatatccaccatatttatctcatc 11074951  T
Q  223 atcttcaaatcttgagaacaagaaaaa 249  Q
    |||||||||||||||||||||||||||    
T  11074950 atcttcaaatcttgagaacaagaaaaa 11074924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 139 - 238
Target Start/End: Complemental strand, 11055744 - 11055644
Alignment:
Q  139 tcttcatcttcaaatttatcaaccttcttcatctacatttt-gacttcaaaagcaaaaagaaatatccatcatatttatctcatcatcttcaaatcttga 237  Q
    ||||||||||||||| ||||||| |||||| ||| ||| || |||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||    
T  11055744 tcttcatcttcaaatgtatcaactttcttcgtctgcatcttcgacttctaaagaaaaaagaaatatccatcatatttatctcatcatcttcaaatcttga 11055645  T
Q  238 g 238  Q
    |    
T  11055644 g 11055644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University