View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1109_low_13 (Length: 302)

Name: NF1109_low_13
Description: NF1109
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1109_low_13
NF1109_low_13
[»] chr5 (1 HSPs)
chr5 (76-222)||(2221033-2221179)


Alignment Details
Target: chr5 (Bit Score: 131; Significance: 6e-68; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 76 - 222
Target Start/End: Complemental strand, 2221179 - 2221033
Alignment:
Q  76 aaatctaagttcaagtaaggacatgtgcgatacatcagatcgggtagtgtctattggccgagtggagggcagctcaatcctattggtgactatgtgaaat 175  Q
    |||||||||||||||||||||||| || |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  2221179 aaatctaagttcaagtaaggacatatgtgatacatcagatcgggtagtgtctgttggccgagtggagggcagctcaatcctattggtgactatgtgaaat 2221080  T
Q  176 gaaaccttgatggatcagattttgatgacgttggttgtgtttgaatt 222  Q
    |||||||||||||| ||||||||||||||||||||||||||||||||    
T  2221079 gaaaccttgatggagcagattttgatgacgttggttgtgtttgaatt 2221033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University