View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11095_low_44 (Length: 232)

Name: NF11095_low_44
Description: NF11095
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11095_low_44
NF11095_low_44
[»] chr4 (1 HSPs)
chr4 (18-214)||(44953998-44954194)


Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 214
Target Start/End: Complemental strand, 44954194 - 44953998
Alignment:
Q  18 agaggacgagcccaaaccgaagaaacgagactttataaaaggataaagggtagagatatcgtagacatgacacattcttaaatactaggttattcatttg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44954194 agaggacgagcccaaaccgaagaaacgagactttataaaaggataaagggtagagatatcgtagacatgacacattcttaaatactaggttattcatttg 44954095  T
Q  118 attggggcaaccactagcccttgacgacaatggtaacctggacttgtgctcttgacaacaacacttacaaatgaaccaaccattgaaggtcgcaagt 214  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  44954094 attggggcaaccactagcccttgacgacaacggtaacctggacttgtgctcttgacaacaacacttacaaatgaaccaaccattgaaggtcgcaagt 44953998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University