View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11093_low_43 (Length: 228)

Name: NF11093_low_43
Description: NF11093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11093_low_43
NF11093_low_43
[»] chr3 (2 HSPs)
chr3 (80-226)||(32083445-32083592)
chr3 (6-57)||(32083641-32083692)


Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 80 - 226
Target Start/End: Complemental strand, 32083592 - 32083445
Alignment:
Q  80 tgtgatgacaaattagtttttgaaaaatgtcaatttttggg-tacctaaaaataaataggtaaactggtcaattttcaatatgtttcatatgatcatagc 178  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32083592 tgtgatgacaaattagtttttgaaaaatgtcaatttttggggtacctaaaaataaataggtaaactggtcaattttcaatatgtttcatatgatcatagc 32083493  T
Q  179 tgaccaatggattcacgttgtcaaaatcttcaaaatggatacatggtt 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
T  32083492 tgaccaatggattcacgttgtcaaaatcttcaaaatggatacatggtt 32083445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 6 - 57
Target Start/End: Complemental strand, 32083692 - 32083641
Alignment:
Q  6 agtttatatatgtcatcggatcattggaaaattttagcgatttcgaaaatgt 57  Q
    ||||||||||||||||| ||||||||||||||||||||||||| ||||||||    
T  32083692 agtttatatatgtcatcagatcattggaaaattttagcgattttgaaaatgt 32083641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University