View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11093_low_42 (Length: 238)

Name: NF11093_low_42
Description: NF11093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11093_low_42
NF11093_low_42
[»] chr8 (1 HSPs)
chr8 (75-132)||(36663201-36663258)


Alignment Details
Target: chr8 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 75 - 132
Target Start/End: Complemental strand, 36663258 - 36663201
Alignment:
Q  75 cttacaatcagaatgggagtgataataataatcatgttcaagatgaagagtagaggtt 132  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  36663258 cttacaatcagaatgggagtgataataataatcatgttcaagatgaagagtagaggtt 36663201  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University