View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11092_low_53 (Length: 238)

Name: NF11092_low_53
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11092_low_53
NF11092_low_53
[»] chr2 (1 HSPs)
chr2 (96-220)||(5554965-5555089)


Alignment Details
Target: chr2 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 96 - 220
Target Start/End: Original strand, 5554965 - 5555089
Alignment:
Q  96 cttaaagaaaaagtctggcccaatttaagcctcatgcagaataatcagtaggttcttgtcagccaatctatcttatttccccctagttggaatgtatgta 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  5554965 cttaaagaaaaagtctggcccaatttaagcctcatgcagaataatcagtaggttcttgtcagccaatctatcttatttccccctagttggaatgtatgta 5555064  T
Q  196 tatactcaattagaagtttgagaag 220  Q
    ||||||||||| |||||||||||||    
T  5555065 tatactcaattggaagtttgagaag 5555089  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University