View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11092_low_47 (Length: 250)

Name: NF11092_low_47
Description: NF11092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11092_low_47
NF11092_low_47
[»] chr2 (1 HSPs)
chr2 (34-239)||(6632682-6632887)


Alignment Details
Target: chr2 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 34 - 239
Target Start/End: Complemental strand, 6632887 - 6632682
Alignment:
Q  34 tacatatccatttagttgatcttttcaaaaaggttaaattacatatttaatttcttacgtttattttagatttaaagtatgtcatttatggttaaaaagt 133  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||    
T  6632887 tacatatccatttagttgatcttttcaaaaaggttaaattacatatttaatctcttacgtgtattttagatttaaagtatgtcatttatggttaaaaagt 6632788  T
Q  134 aagtttccatggttaagtgatgtttattttagatttaaaattggtcatttacgtttaaaaagtttccatggttaagtgatttacttactcactctgttat 233  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||||||||||||| | ||    
T  6632787 aagtttccatggttaagtgatgtttattttagatttaaaattggtcgtttacatttaaaaagttttcatggttaagtgatttacttactcactctatcat 6632688  T
Q  234 attcat 239  Q
    ||||||    
T  6632687 attcat 6632682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University