View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1107_low_125 (Length: 250)

Name: NF1107_low_125
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1107_low_125
NF1107_low_125
[»] chr2 (2 HSPs)
chr2 (28-174)||(33678478-33678624)
chr2 (216-250)||(33678666-33678700)


Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 28 - 174
Target Start/End: Original strand, 33678478 - 33678624
Alignment:
Q  28 agttatgagttgaaattgtctattcaaacggtcaaaggaagaagtcccttaaaaactagagtttgcagccttctcaatatgtttaatataccaaggcatg 127  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  33678478 agttatgagttgaaattgtctattcaaacggtcaaaggaagaagtcccttaaaaactagagtttgcagccttctcaatatgtttaatataccaaggcatg 33678577  T
Q  128 gattgacacttatatgtagttgactaatcaagatcaagaatttatag 174  Q
    || ||||||||||||||||||||||||||||||||||||||||||||    
T  33678578 gaatgacacttatatgtagttgactaatcaagatcaagaatttatag 33678624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 216 - 250
Target Start/End: Original strand, 33678666 - 33678700
Alignment:
Q  216 caacattcttggcgcagacaagacgaaattgcttt 250  Q
    |||||||||||||||||||||||||||||| ||||    
T  33678666 caacattcttggcgcagacaagacgaaattacttt 33678700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University