View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1107_low_114 (Length: 264)

Name: NF1107_low_114
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1107_low_114
NF1107_low_114
[»] chr8 (1 HSPs)
chr8 (11-45)||(7501847-7501881)
[»] chr3 (1 HSPs)
chr3 (131-205)||(27257795-27257869)


Alignment Details
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 11 - 45
Target Start/End: Complemental strand, 7501881 - 7501847
Alignment:
Q  11 cacagataagtggcctccgcctccctttttccctt 45  Q
    |||||||||||||||||||||||||||||||||||    
T  7501881 cacagataagtggcctccgcctccctttttccctt 7501847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 131 - 205
Target Start/End: Original strand, 27257795 - 27257869
Alignment:
Q  131 tgaatacttgcaagagaatttgaagttaagttggattgtaatcgatccaactcaaaagcatgcagctaacttgtt 205  Q
    |||||| |||||||| ||||||| ||| |||||| |||| ||||||||||||| ||||| |||||| || |||||    
T  27257795 tgaatatttgcaagaaaatttgaggttgagttgggttgttatcgatccaactcgaaagcgtgcagcaaagttgtt 27257869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University