View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1107_low_104 (Length: 280)

Name: NF1107_low_104
Description: NF1107
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1107_low_104
NF1107_low_104
[»] scaffold0066 (1 HSPs)
scaffold0066 (38-237)||(22116-22315)


Alignment Details
Target: scaffold0066 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: scaffold0066
Description:

Target: scaffold0066; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 38 - 237
Target Start/End: Original strand, 22116 - 22315
Alignment:
Q  38 ccctagctgttgctgactgatgtaaagatctccgtggaagcaaaggagaaatatttaccggtgggggcaatatgcctacatgatcattgaaacctggaac 137  Q
    |||||| |||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22116 ccctagatgttgcggactgatgtaaagatcttcgtggaagcaaaggagaaatatttaccggtgggggcaatatgcctacatgatcattgaaacctggaac 22215  T
Q  138 cggaacagagccaaaaattggaattgtggacggattaaatggtggtgcagaagctgaaagtttcttggttggttcttttccggtttctatttcttctttc 237  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22216 cggaacagagccaaaaattggaattgtggacggattaaatggtggtgcagaagctgaaagtttcttggttggttcttttccggtttctatttcttctttc 22315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University