View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11074_high_9 (Length: 206)

Name: NF11074_high_9
Description: NF11074
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11074_high_9
NF11074_high_9
[»] chr1 (1 HSPs)
chr1 (17-190)||(37057533-37057706)


Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 17 - 190
Target Start/End: Complemental strand, 37057706 - 37057533
Alignment:
Q  17 cattttatacttagtttgagtgtttgcatgtataccattccccttcgcaagagaatgagttgttgttcaaagtttaaccacttcaacgcctccgcaacaa 116  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37057706 cattttatacttagttggagtgtttgcatgtataccattccccttcgcaagagaatgagttgttgttcaaagtttaaccacttcaacgcctccgcaacaa 37057607  T
Q  117 tcatcggactgtagatcttagatcccatcatgtcgaattagatacatatccatcattcaatcacttaatttcat 190  Q
    ||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||    
T  37057606 tcatcggaccgtagatcttagatcccatcatgtcgaattagatacatatcaatcattcaatcacttaatttcat 37057533  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University