View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11069_low_42 (Length: 211)

Name: NF11069_low_42
Description: NF11069
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11069_low_42
NF11069_low_42
[»] chr2 (2 HSPs)
chr2 (83-193)||(9574967-9575077)
chr2 (15-86)||(9575109-9575180)


Alignment Details
Target: chr2 (Bit Score: 95; Significance: 1e-46; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 83 - 193
Target Start/End: Complemental strand, 9575077 - 9574967
Alignment:
Q  83 ccacaatgggattctctcaaattattttgaccactctttatttatttatcaacatggcaatgacatcgtctatattcttttgtatgtggatgccattatt 182  Q
    ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||| |||    
T  9575077 ccacaatgggattctcttaaattattttgaccactctttatttatttatcaacatggcaatgacaccgtctatattcttttgtatgtggatgacatcatt 9574978  T
Q  183 cttgccgcttc 193  Q
    |||||||||||    
T  9574977 cttgccgcttc 9574967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 15 - 86
Target Start/End: Complemental strand, 9575180 - 9575109
Alignment:
Q  15 catcatactcaactccctggccatgtctgtcttctaaaaaattctctccatggacttatacaagcaccccac 86  Q
    |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
T  9575180 catcatactcaactccctggccatgtatgtcttctaaaaaattctctccatggacttatacaagcaccccac 9575109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University