View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11069A_low_224 (Length: 235)

Name: NF11069A_low_224
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11069A_low_224
NF11069A_low_224
[»] chr6 (2 HSPs)
chr6 (19-60)||(2677883-2677924)
chr6 (133-181)||(2585832-2585881)


Alignment Details
Target: chr6 (Bit Score: 42; Significance: 0.000000000000005; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 19 - 60
Target Start/End: Original strand, 2677883 - 2677924
Alignment:
Q  19 cgtgattttaaattggtttattttctcaaatttattactggc 60  Q
    ||||||||||||||||||||||||||||||||||||||||||    
T  2677883 cgtgattttaaattggtttattttctcaaatttattactggc 2677924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 133 - 181
Target Start/End: Complemental strand, 2585881 - 2585832
Alignment:
Q  133 ttaaggacaagattttaaaccgtgatcacgtaa-gatccttgatactttg 181  Q
    ||||| ||||| ||||||| ||||||||||||| ||||||||||||||||    
T  2585881 ttaagcacaaggttttaaatcgtgatcacgtaaggatccttgatactttg 2585832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University