View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11069A_low_202 (Length: 241)

Name: NF11069A_low_202
Description: NF11069A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11069A_low_202
NF11069A_low_202
[»] chr5 (1 HSPs)
chr5 (11-241)||(19190389-19190619)


Alignment Details
Target: chr5 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 11 - 241
Target Start/End: Complemental strand, 19190619 - 19190389
Alignment:
Q  11 atcacgaccatccctaccataccctccaaaactttgctcattaccgtaaccactagaacgccctccatatccatagccaccactagaacggttttcttcg 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19190619 atcacgaccatccctaccataccctccaaaactttgctcattaccgtaaccactagaacgccctccatatccatagccaccactagaacggttttcttcg 19190520  T
Q  111 ccatatccaccaatactcgtacgccctccatcaccatatccacccccagaacgcccatatccactctcataacggtcattagcgccataaccaccaccag 210  Q
    ||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  19190519 ccatatccaccaatactcgaacgccctccatcaccatatccaccaccagaacgcccatatccactctcataacggtcattagcgccataaccaccaccag 19190420  T
Q  211 aacggtcatcggaaccataaccaccaccaaa 241  Q
    |||||||||||||||||||||||||||||||    
T  19190419 aacggtcatcggaaccataaccaccaccaaa 19190389  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University