View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11068_low_15 (Length: 247)

Name: NF11068_low_15
Description: NF11068
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11068_low_15
NF11068_low_15
[»] chr1 (1 HSPs)
chr1 (42-247)||(50392134-50392343)


Alignment Details
Target: chr1 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 42 - 247
Target Start/End: Complemental strand, 50392343 - 50392134
Alignment:
Q  42 atagcaatatcactcataacaaacctttcactagaaaggcttattgttgaacacccataatattatttattgtggagtttcttgatgtgagagagcaata 141  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  50392343 atagcaatatcactcataacaaacctttcactagaaaggcttattgttgaacacccataatattatttattgtggagtttcttgatgtgagagagcaata 50392244  T
Q  142 tccatgatcctgatgatattttcatattagagaaaacattcattgaatgaaaaacaatagaataaatgg----tagcaaacaacaaagatagaatgaaga 237  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    |||||||||||||||||||||||||||    
T  50392243 tccatgatcctgatgatattttcatattagagaaaacattcattgaatgaaaaagaatagaataaatggtagctagcaaacaacaaagatagaatgaaga 50392144  T
Q  238 ggatgataat 247  Q
    ||||||||||    
T  50392143 ggatgataat 50392134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University