View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11064_high_2 (Length: 229)

Name: NF11064_high_2
Description: NF11064
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11064_high_2
NF11064_high_2
[»] chr2 (1 HSPs)
chr2 (22-211)||(7908340-7908538)


Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 22 - 211
Target Start/End: Original strand, 7908340 - 7908538
Alignment:
Q  22 atggtgctggctcggaagaagagaaagaatcagcgtggaaagtagttattgagtttctccggcagaaggaggcagttccgttggataattttttgaag-- 119  Q
    |||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||      
T  7908340 atggtgctggttcggaagaagagaaagaatcggcgtggaaagtagttattgagtttctccggcagaaggaggcagttccgttggataattttttgaagat 7908439  T
Q  120 -------ggtatcaaagagcaatatgaaagtatcagagatgatatgcaaatagcggaggatagagtgaaatgtctccaaaacattctgcaggtccgttt 211  Q
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  7908440 tttgaggggtatcaaagagcaatatgaaagtatcagagatgatatgcaaatagcggaggatatagtgaaatgtctccaaaacattctgcaggtccgttt 7908538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University