View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11050_low_21 (Length: 245)

Name: NF11050_low_21
Description: NF11050
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11050_low_21
NF11050_low_21
[»] chr7 (2 HSPs)
chr7 (16-236)||(40238104-40238324)
chr7 (46-119)||(40243780-40243853)


Alignment Details
Target: chr7 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 40238104 - 40238324
Alignment:
Q  16 agtaattcatccccttctagctttgatcttttgtggctagctctgtggccacctagtgcttgaaaggatgggaattttttgttgcacgttttgcactcat 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40238104 agtaattcatccccttctagctttgatcttttgtggctagctctgtggccacctagtgcttgaaaggatgggaattttttgttgcacgttttgcactcat 40238203  T
Q  116 attccactggtgcaaaacttttttgatttggtttattgttttgtggttgatgttggggataagagagcatcattagacaatttgctaaatctatgttttc 215  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40238204 attccactggtgcaaaacttttttgatttggtttattgttttgtggttgatgttggggataagagagcatcattagacaatttgctaaatctatgttttc 40238303  T
Q  216 taacccttcgaaatctctctg 236  Q
    |||||||||||||||||||||    
T  40238304 taacccttcgaaatctctctg 40238324  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 46 - 119
Target Start/End: Original strand, 40243780 - 40243853
Alignment:
Q  46 ttgtggctagctctgtggccacctagtgcttgaaaggatgggaattttttgttgcacgttttgcactcatattc 119  Q
    ||||||||||| || |||||||| || |||||||| |||| |||||||||||||||||||||||| ||||||||    
T  40243780 ttgtggctagccctatggccaccaagggcttgaaaagatgagaattttttgttgcacgttttgcattcatattc 40243853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University