View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1104_low_70 (Length: 292)

Name: NF1104_low_70
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1104_low_70
NF1104_low_70
[»] chr3 (1 HSPs)
chr3 (56-200)||(16871618-16871759)


Alignment Details
Target: chr3 (Bit Score: 111; Significance: 5e-56; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 111; E-Value: 5e-56
Query Start/End: Original strand, 56 - 200
Target Start/End: Complemental strand, 16871759 - 16871618
Alignment:
Q  56 tgttgccttttaccatcaagcttcattaattaacaagtgcttacatggctgttttattgctattgtgacaagtttttgttggtggtgaaaaatatattgt 155  Q
    ||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| | ||||||||||||||    
T  16871759 tgttgcctttttccatcaagcttcgttaattaacaagtgcttaaatggctgttttattgctattgtgacaagtttttgttggttgagaaaaatatattgt 16871660  T
Q  156 ggcaagttcaaataagcaatatgtattttctaattaatttttact 200  Q
    ||||||||||   ||||||||||||||||||||||||||||||||    
T  16871659 ggcaagttca---aagcaatatgtattttctaattaatttttact 16871618  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University