View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1104_high_29 (Length: 385)

Name: NF1104_high_29
Description: NF1104
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1104_high_29
NF1104_high_29
[»] chr1 (4 HSPs)
chr1 (30-98)||(24900754-24900822)
chr1 (178-245)||(24900843-24900906)
chr1 (257-374)||(24900931-24901043)
chr1 (38-76)||(24883951-24883989)


Alignment Details
Target: chr1 (Bit Score: 65; Significance: 2e-28; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 30 - 98
Target Start/End: Original strand, 24900754 - 24900822
Alignment:
Q  30 gttcatgttataggtttgggggatggttgcaacatttgttgaatatcatgtcctttggtatttcattga 98  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  24900754 gttcatgttataggtttgggggatggttgcaacatttgttgaatatcatgtcctttggtacttcattga 24900822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 178 - 245
Target Start/End: Original strand, 24900843 - 24900906
Alignment:
Q  178 tagatcggggagcgggtgacaaacaatagtaaagttgattgaatgatttagtgacctattaggttcgg 245  Q
    ||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||    
T  24900843 tagatcggggagcgggtgacaa----tagtaaagttgattgaatgatttagtgacctattaggttcgg 24900906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 257 - 374
Target Start/End: Original strand, 24900931 - 24901043
Alignment:
Q  257 taaattaaaaggtcgcaaatgacttgcaaatatggcctaaaagttgcataatttnnnnnnnnnnnnnnnnntgacggaacataacctgcaaaatgtcctt 356  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||                 |||||||||||||||||||| ||||||||    
T  24900931 taaattaaaaggtcgtaaatgacttgcaaatatggcctaaaagttgcataatttaaaaaaaaaaaa-----tgacggaacataacctgcaatatgtcctt 24901025  T
Q  357 tttactctattaagtata 374  Q
    ||||||||||||| ||||    
T  24901026 tttactctattaactata 24901043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 38 - 76
Target Start/End: Complemental strand, 24883989 - 24883951
Alignment:
Q  38 tataggtttgggggatggttgcaacatttgttgaatatc 76  Q
    |||||||||||||| ||||||||||||||||||||||||    
T  24883989 tataggtttgggggctggttgcaacatttgttgaatatc 24883951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University