View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11039_low_38 (Length: 210)

Name: NF11039_low_38
Description: NF11039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11039_low_38
NF11039_low_38
[»] chr4 (2 HSPs)
chr4 (1-90)||(3902981-3903071)
chr4 (138-194)||(3902908-3902964)


Alignment Details
Target: chr4 (Bit Score: 83; Significance: 2e-39; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 1 - 90
Target Start/End: Complemental strand, 3903071 - 3902981
Alignment:
Q  1 acaacctacatcttgaaatatttgtggagacttgcttttttggcctcccaaaaatactaa-attgttccgttcataactatcgaacgacaa 90  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
T  3903071 acaacctacatcttgaaatatttgtggagacttgcttttttggcctcccaaaaatactaatattgttccgttcataactatcgaacgacaa 3902981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 138 - 194
Target Start/End: Complemental strand, 3902964 - 3902908
Alignment:
Q  138 ccagcataactagaaaaacaaagctcatatttgtgagcttttgtccatctatggtct 194  Q
    |||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||    
T  3902964 ccagcataactagaaaaacacagctcatatttgtgagcttttgttcatctatggtct 3902908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University