View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11039_low_24 (Length: 264)

Name: NF11039_low_24
Description: NF11039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11039_low_24
NF11039_low_24
[»] chr5 (1 HSPs)
chr5 (1-80)||(32282627-32282706)
[»] scaffold0209 (1 HSPs)
scaffold0209 (19-61)||(30207-30249)
[»] chr8 (2 HSPs)
chr8 (19-61)||(589110-589152)
chr8 (19-61)||(624770-624812)
[»] chr3 (1 HSPs)
chr3 (26-59)||(26535104-26535137)


Alignment Details
Target: chr5 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 1 - 80
Target Start/End: Original strand, 32282627 - 32282706
Alignment:
Q  1 gcatgttaagatctgaagttcgattttctttggtgtcaatttcaatggacaagtccatataaattggatgctgagttttc 80  Q
    |||||||| |||| || ||||||||  ||||| ||||||||| | ||| |||||||||||||||||||||||||||||||    
T  32282627 gcatgttacgatccgaggttcgattccctttgttgtcaattttagtgggcaagtccatataaattggatgctgagttttc 32282706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0209 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0209
Description:

Target: scaffold0209; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 30207 - 30249
Alignment:
Q  19 ttcgattttctttggtgtcaatttcaatggacaagtccatata 61  Q
    ||||||||  |||| ||||||||||||||||||||||||||||    
T  30207 ttcgatttcttttgatgtcaatttcaatggacaagtccatata 30249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Complemental strand, 589152 - 589110
Alignment:
Q  19 ttcgattttctttggtgtcaatttcaatggacaagtccatata 61  Q
    ||||||||  |||| ||||||||||||||||||||||||||||    
T  589152 ttcgatttcttttgatgtcaatttcaatggacaagtccatata 589110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 19 - 61
Target Start/End: Original strand, 624770 - 624812
Alignment:
Q  19 ttcgattttctttggtgtcaatttcaatggacaagtccatata 61  Q
    ||||||||  |||| ||||||||||||||||||||||||||||    
T  624770 ttcgatttcttttgatgtcaatttcaatggacaagtccatata 624812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 26 - 59
Target Start/End: Original strand, 26535104 - 26535137
Alignment:
Q  26 ttctttggtgtcaatttcaatggacaagtccata 59  Q
    ||||||||||||||||||| ||||||||||||||    
T  26535104 ttctttggtgtcaatttcagtggacaagtccata 26535137  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University