View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11029_high_41 (Length: 204)

Name: NF11029_high_41
Description: NF11029
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11029_high_41
NF11029_high_41
[»] chr7 (1 HSPs)
chr7 (1-188)||(21483140-21483327)


Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 188
Target Start/End: Original strand, 21483140 - 21483327
Alignment:
Q  1 ccagttcgctggatttgcatgagacccaccagcagcaacattggtgcaattatcaccactacctaatctcgcaagtggatcagaacctggaatattctga 100  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||    
T  21483140 ccagttcgctggatttgcatgagaaccaccagcagcaacattggtgcaactatcaccactacctaatctcgcaagtggatcagaaccttgaatattctga 21483239  T
Q  101 tgatggttattattatgatgcctatgatgagacataaaccgccgttgccgagccatcctcttctttctagcttcttttgtagcagaag 188  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21483240 tgatggttaatattatgatgcctatgatgagacataaaccgccgttgccgagccatcctcttctttctagcttcttttgtagcagaag 21483327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University