View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11025_low_21 (Length: 248)

Name: NF11025_low_21
Description: NF11025
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11025_low_21
NF11025_low_21
[»] chr7 (1 HSPs)
chr7 (65-180)||(42037456-42037571)


Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 65 - 180
Target Start/End: Original strand, 42037456 - 42037571
Alignment:
Q  65 taattaagaaccctaacctcaattgcacagagaaagaaaatgcttggttcaccaataactattagcactctatttaattttagtgtttgtatgtgtgcct 164  Q
    ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42037456 taattaagaaccctaacctcaattgcacagagaaagaaaatacttggttcaccaataactattagcactctatttaattttagtgtttgtatgtgtgcct 42037555  T
Q  165 gtgtgaaaccagagat 180  Q
    ||||||||||||||||    
T  42037556 gtgtgaaaccagagat 42037571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University