View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11007_low_20 (Length: 219)

Name: NF11007_low_20
Description: NF11007
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11007_low_20
NF11007_low_20
[»] chr1 (1 HSPs)
chr1 (108-201)||(31284859-31284952)


Alignment Details
Target: chr1 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 108 - 201
Target Start/End: Original strand, 31284859 - 31284952
Alignment:
Q  108 tttcaacataattatggaaaaagtgaaacaaggattgagttcttgtccaattgattatgaagtttctaataccatgttaagaatcagttattcc 201  Q
    |||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| || ||||||||||||||||||    
T  31284859 tttcaaaataattatggaaaaagtgaaacaaggattgagttattgtccaattgattatgaagtttctaatacaattttaagaatcagttattcc 31284952  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University