View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10996_low_11 (Length: 352)

Name: NF10996_low_11
Description: NF10996
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10996_low_11
NF10996_low_11
[»] scaffold0011 (1 HSPs)
scaffold0011 (1-336)||(240615-240950)


Alignment Details
Target: scaffold0011 (Bit Score: 328; Significance: 0; HSPs: 1)
Name: scaffold0011
Description:

Target: scaffold0011; HSP #1
Raw Score: 328; E-Value: 0
Query Start/End: Original strand, 1 - 336
Target Start/End: Complemental strand, 240950 - 240615
Alignment:
Q  1 gtgaaagatcacgtgagggtcattttgttgtatttttgggtacatagatcatgtgggatcatgctgtaacttgtgtataagagaagtactgtccagaaaa 100  Q
    ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||    
T  240950 gtgaaagatcacgtgagggtcattttgttgtttttttgggtacatagatcatgtgggatcatgctgtaacttgtgtataagagaagtactgtccagcaaa 240851  T
Q  101 gtggatggtggcttattatctaaggggttgcgtttgaattttgggtttaaacactcgaaaaatatggggtgttggatgatttatttcacatgggatagct 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  240850 gtggatggtggcttattatctaaggggttgcgtttgaattttgggtttaaacactcgaaaaatatggggtgttggatgatttatttcacatgggatagct 240751  T
Q  201 gacttgtgagacactttaccaatatagaatacgacttgcactttgctcatattgcaatcttccgagtctcagttttggtaaaattttagcaccttagtta 300  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  240750 gacttgtgagacactttaccaatatagaatacgacttgcactttgctcatattgcaatcttccgagtctcagttttggtaaaattttagcaccttagtta 240651  T
Q  301 aatagagacataaaatagaacaatacagcaaattcc 336  Q
    ||||||||||||||||||||||||||||||||||||    
T  240650 aatagagacataaaatagaacaatacagcaaattcc 240615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University