View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10979_low_18 (Length: 229)

Name: NF10979_low_18
Description: NF10979
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10979_low_18
NF10979_low_18
[»] chr7 (1 HSPs)
chr7 (1-216)||(38466103-38466318)


Alignment Details
Target: chr7 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 216
Target Start/End: Complemental strand, 38466318 - 38466103
Alignment:
Q  1 cttgtgtggtgattttttgttactgaggaacgttttctgacataggggaatgcctaaaaaggttgtgggttgtgatgcatggcggttttgtaaggtacat 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38466318 cttgtgtggtgattttttgttactgaggaacgttttctgacataggggaatgcctaaaaaggttgtgggttgtgatgcatggcggttttgtaaggtacat 38466219  T
Q  101 accgttgatagtgaggatgagaaggtagaacttgctgctactgccatggtgtttgtaaattgtaacgcaagtttagccagtgaaatcttatcctacgtta 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  38466218 accgttgatagtgaggatgagaaggtagaacttgctgctactgccatggtgtttgtaaattgtaacgcaagtttagccagtgaaatcttatcctacgtta 38466119  T
Q  201 gttagggtatgggcct 216  Q
    ||||||||||||||||    
T  38466118 gttagggtatgggcct 38466103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University