View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10970_high_23 (Length: 275)

Name: NF10970_high_23
Description: NF10970
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10970_high_23
NF10970_high_23
[»] chr5 (2 HSPs)
chr5 (100-270)||(11196941-11197111)
chr5 (23-61)||(11196864-11196902)


Alignment Details
Target: chr5 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 100 - 270
Target Start/End: Original strand, 11196941 - 11197111
Alignment:
Q  100 agtttcagctactacttcacaaggtggttctagtggaagtactagtactgtttctgcttctgttactgctacttcaacttttcaaacacttcctttgcat 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11196941 agtttcagctactacttcacaaggtggttctagtggaagtactagtactgtttctgcttctgttactgctacttcaacttttcaaacacttcctttgcat 11197040  T
Q  200 acaaatggtactcgtgaaggtttaagtttcaatcttgggaacaccgtgccccacatggaccctatgcttct 270  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  11197041 acaaatggtactcgtgaaggtttaagtttcaatcttgggaacaccgtgccccacatggaccctatgcttct 11197111  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 23 - 61
Target Start/End: Original strand, 11196864 - 11196902
Alignment:
Q  23 atgattcgacgtcgttaccgttcaagaaagcctgtggaa 61  Q
    |||||||||||||||||||||||||||||||||||||||    
T  11196864 atgattcgacgtcgttaccgttcaagaaagcctgtggaa 11196902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University